View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0906_high_14 (Length: 246)
Name: NF0906_high_14
Description: NF0906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0906_high_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 183
Target Start/End: Original strand, 4607919 - 4608087
Alignment:
| Q |
15 |
ctagctcacgggtttctttgttttttagtgggtatctttcatacgtaatagtacacattgttccagaaagttttccaattgttgttggaaccatttgaca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
4607919 |
ctagctcacgggtttctttgttttttagtgggtatctttcatacgtaatagtacacattgttccagaaagttttccaattgttgttggaaccatttgcca |
4608018 |
T |
 |
| Q |
115 |
gtgattttttagattgttattgggtgagttgaaagtactttttgaatttaagattagatatcatatgaa |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4608019 |
gtgattttttagattgttattgggtgagttgaaagtactttttgaatttaagattagatatcatatgaa |
4608087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University