View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0906_low_13 (Length: 453)
Name: NF0906_low_13
Description: NF0906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0906_low_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 114 - 302
Target Start/End: Complemental strand, 29145457 - 29145269
Alignment:
| Q |
114 |
ctgtgcatgatcacgcggaaaagtgacaaaattgaagtcaaaatattattaaaaggtaagtaaaccaataatggtttagttgccaaatacgaatttgaag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29145457 |
ctgtgcatgatcacgcggaaaagtgacaaaattgaagtcaaaatattattaaaaggtaagtaaaccaataatggtttagttgccaaatacgaatttgaag |
29145358 |
T |
 |
| Q |
214 |
aagacaggcaatcctttcttttcaaagaggttggctgatgctgcacgactgcttgcttgattgaccaacattaaattaagttaaagccc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29145357 |
aagacaggcaatcctttcttttcaaagaggttggctgatgctgcacgactgcttgcttgattgaccaacattaaattaagttaaagccc |
29145269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 332 - 374
Target Start/End: Complemental strand, 29145239 - 29145197
Alignment:
| Q |
332 |
gtccttacctaggtacagttccactttattatactctctgctc |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29145239 |
gtccttacctaggtacagttccactttattatactctctgctc |
29145197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 114; Significance: 1e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 1 - 118
Target Start/End: Original strand, 52926083 - 52926200
Alignment:
| Q |
1 |
tcatcagcatttactctggtgattgcggagcggtgagcacgatcctcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagggtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926083 |
tcatcagcatttactctggtgattgcggagcggtgagcacgatcttcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagggtg |
52926182 |
T |
 |
| Q |
101 |
gaacgggagcatcctgtg |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
52926183 |
gaacgggagcatcctgtg |
52926200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University