View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0906_low_16 (Length: 417)
Name: NF0906_low_16
Description: NF0906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0906_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 16 - 395
Target Start/End: Original strand, 4951478 - 4951868
Alignment:
| Q |
16 |
aaacgaactctaaactatgcgattaagaggataagtattgatcacnnnnnnn-----ctctttcaaaaatcacttat----------gatggtgatcggc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
4951478 |
aaacgaactctaaactatgcgattaagaggataagtattgatcacttttttttttctctctttcaaaaatcacttatgttacattatgatggtgatcggc |
4951577 |
T |
|
| Q |
101 |
tctttttaatttaaagaagaaacaacacttgtaccaagcaatcagtttgccaacaaggaagttatgaattttttacagaaggaaagttattattaattaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4951578 |
tctttttaatttaaagaagaaacaacacttgtaccaagcaatcagtttgccaacaaggaagttatgaattttttacagaaggaaag---ttattaattaa |
4951674 |
T |
|
| Q |
201 |
tcaactttgatgtatgtcattagagccgggatgagatgacggatcatatgggtccatgtgatttaaatttgatagttgaaaac----taattaatttacg |
296 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
4951675 |
tcaactttggtgtatgtcattagagccgg-----gatgacggatcatatgggtccatgtgatttaaatttgatagttgcaaactaattaattaatttacg |
4951769 |
T |
|
| Q |
297 |
aaacatcttggacccaccatggattttgtgatctccttgctaatctggtaatcgttttaaaatagtgtacatcaatttcttctagagctgtggtctgtg |
395 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4951770 |
aaacagcttggacccaccatagattttgtgatctccttgctaatctggtaatcgttttaaaatagtgtacatcaatttcttctagagctgtggtctgtg |
4951868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 402 times since January 2019
Visitors: 6703