View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0906_low_20 (Length: 375)

Name: NF0906_low_20
Description: NF0906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0906_low_20
NF0906_low_20
[»] chr7 (3 HSPs)
chr7 (298-375)||(5805896-5805973)
chr7 (187-242)||(5806029-5806084)
chr7 (70-114)||(39488893-39488937)


Alignment Details
Target: chr7 (Bit Score: 70; Significance: 2e-31; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 298 - 375
Target Start/End: Complemental strand, 5805973 - 5805896
Alignment:
298 ctgcagaattttccaagaatttattatacagctaagatacgtgaggattttgcttcaaaactgtttcctgtctatatt 375  Q
    |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||    
5805973 ctgcagaattttccaagaatttattagacagctaagatatgtgaggattttgcttcaaaactgtttcctgtctatatt 5805896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 187 - 242
Target Start/End: Complemental strand, 5806084 - 5806029
Alignment:
187 cggttcattaacaaatgttgtgacttcaattcaaaatggtccatattcaattagca 242  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5806084 cggttcattaacaaatgttgtgacttcaattcaaaatggtccatattcaattagca 5806029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 70 - 114
Target Start/End: Original strand, 39488893 - 39488937
Alignment:
70 ttcattgttgctgactgtttagatattttgtttagtttattaaat 114  Q
    |||||| ||| |||||||||||| |||||| ||||||||||||||    
39488893 ttcattattgttgactgtttagacattttggttagtttattaaat 39488937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University