View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0906_low_22 (Length: 343)
Name: NF0906_low_22
Description: NF0906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0906_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 1 - 317
Target Start/End: Complemental strand, 7831889 - 7831573
Alignment:
| Q |
1 |
ctacagaacaattttggcatttcatcagaataacaatatttctcaccctctccctaaatgtttcttccccattccagcttctccaaccaagaggatctcc |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||||||||| |||| |||||||| |
|
|
| T |
7831889 |
ctacagaacaattttggcatttcaacagaataacaatatttctcaccctctcccaaaaggtttctttcccattccagcttctccaaacaagtggatctcc |
7831790 |
T |
|
| Q |
101 |
atcttgtaactcaacgcgtccccaatagcgacgtcttggagctgagtcttcatcttcgactcctttccagaacaatctctctccagttcctctcggtttc |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7831789 |
atcttgtaactcaacgcttccccaatagcgacgtcttggagctgagacttcatcttcggctcctttccagaacaaactctctccagttcctctcggtttc |
7831690 |
T |
|
| Q |
201 |
tcttgactcatctcttcattctgtacatcctttctctgtgctttcactcctcnnnnnnnctgctgctgaggtagaagggtctgagaggattccaattgtt |
300 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7831689 |
tcttgacacatctcttcattctatacatcctttctctgtgctttcactcctctttttttctgctgctgaggtagaagggtctgagaggattccaattgtt |
7831590 |
T |
|
| Q |
301 |
cggctaaatctgcatga |
317 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
7831589 |
cggctaaatctgcatga |
7831573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 457 times since January 2019
Visitors: 6703