View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0906_low_29 (Length: 321)
Name: NF0906_low_29
Description: NF0906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0906_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 1e-56; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 103 - 234
Target Start/End: Original strand, 34288370 - 34288501
Alignment:
Q |
103 |
attcatatattttttctcaacaatttcaattgtgagatgctctaggttagggcaactctttagcatgaatgtgattccctcaaactcaagcgtgtgcaaa |
202 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
T |
34288370 |
attcatatattttttctcaacaatttcaattgtgagatgctctaggttagggcagctctttagcatgaatgcgattccctcaaactcaagcgggtgcaaa |
34288469 |
T |
 |
Q |
203 |
aaggtattcattatcaaatatttcaccttcat |
234 |
Q |
|
|
||||| ||||||||||||| |||||||||||| |
|
|
T |
34288470 |
aaggtcttcattatcaaatgtttcaccttcat |
34288501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 103 - 234
Target Start/End: Original strand, 34297673 - 34297804
Alignment:
Q |
103 |
attcatatattttttctcaacaatttcaattgtgagatgctctaggttagggcaactctttagcatgaatgtgattccctcaaactcaagcgtgtgcaaa |
202 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||||||||| || || ||||| || |||||||||||||||||||||| |||||||| | ||||||| |
|
|
T |
34297673 |
attcatatatcttttctcaacaatttcaattgtgagatgctcaagattggggcagctgtttagcatgaatgtgattccctaaaactcaaactggtgcaaa |
34297772 |
T |
 |
Q |
203 |
aaggtattcattatcaaatatttcaccttcat |
234 |
Q |
|
|
|||| |||||||||| || |||||||||||| |
|
|
T |
34297773 |
gaggtcttcattatcatatgtttcaccttcat |
34297804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 104 - 233
Target Start/End: Original strand, 34281960 - 34282089
Alignment:
Q |
104 |
ttcatatattttttctcaacaatttcaattgtgagatgctctaggttagggcaactctttagcatgaatgtgattccctcaaactcaagcgtgtgcaaaa |
203 |
Q |
|
|
||||||||||||| |||||||||||||||| ||||| ||||| ||||||||||||| ||||||| ||||||||| ||||||||| || | || ||| |
|
|
T |
34281960 |
ttcatatatttttcttcaacaatttcaattgcgagatactctaagttagggcaactcgttagcataaatgtgatttcctcaaacttaaactaatgtaaag |
34282059 |
T |
 |
Q |
204 |
aggtattcattatcaaatatttcaccttca |
233 |
Q |
|
|
|||| ||||||||||||| ||||||||||| |
|
|
T |
34282060 |
aggtcttcattatcaaatgtttcaccttca |
34282089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 114 - 234
Target Start/End: Original strand, 10330846 - 10330966
Alignment:
Q |
114 |
ttttctcaacaatttcaattgtgagatgctctaggttagggcaactctttagcatgaatgtgattccctcaaactcaagcgtgtgcaaaaaggtattcat |
213 |
Q |
|
|
|||| ||||||||||||||||||||| | |||| || |||||||||||||||||||||| ||||||| |||||||| |||||||| || ||||| |
|
|
T |
10330846 |
ttttatcaacaatttcaattgtgagacgttctaagtcggggcaactctttagcatgaatgagattcccataaactcaaatttgtgcaaagcagtcttcat |
10330945 |
T |
 |
Q |
214 |
tatcaaatatttcaccttcat |
234 |
Q |
|
|
|||||||| |||||| |||| |
|
|
T |
10330946 |
tatcaaatgcttcaccctcat |
10330966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 101 times since January 2019
Visitors: 6700