View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0906_low_42 (Length: 251)
Name: NF0906_low_42
Description: NF0906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0906_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 89 - 241
Target Start/End: Complemental strand, 9711010 - 9710854
Alignment:
Q |
89 |
tactaaatacaaaccaactaaataaacgatattctcctatctcttaagtattctacttatgtttcaaccttttaggtcaaaaagagctccacacactaaa |
188 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9711010 |
tactaaatacaaaccaactaaataaacgatattctcctatctcttaagtattctacttatgtttcaaccttttaggtcaaaaagagctccacacactaaa |
9710911 |
T |
 |
Q |
189 |
ggaaaataatatgatgcttg----gcattctccccatccctaagcattctacctatg |
241 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
9710910 |
ggaaaataatatgatgcttggcatgcattctccccatccctaagcattctacctatg |
9710854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University