View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0906_low_43 (Length: 250)
Name: NF0906_low_43
Description: NF0906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0906_low_43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 9945955 - 9946184
Alignment:
| Q |
1 |
ccttctccctctccataccaccctacagtcattgtcattgtcatcattgcatttggcggcattgccttgctctccatgcttgcttttgcattattttgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9945955 |
ccttctccctctccataccaccctacagtcattgtcattgtcatcattgcatttggtggcattgccttgctctccatgcttgcttttgcattattttgct |
9946054 |
T |
|
| Q |
101 |
gcgttcaaaagaggaagaagaaacaagaaaccgatatcgttcatatcaatgaacataaaaagatcacggaaaatattgtgcctggtcctaatggacaacc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||| |||||||||||||||| |||||||| ||||||||||||||| ||||||||| |
|
|
| T |
9946055 |
gcgttcaaaagaggaagaagaaacaagaaaccgatgtcattcatatcgatgaacataaaaagattacggaaaacattgtgcctggtccttttggacaacc |
9946154 |
T |
|
| Q |
201 |
actggtggtggttacagttgaagatgatgt |
230 |
Q |
| |
|
| ||||||||||||||||||||||||||| |
|
|
| T |
9946155 |
aacggtggtggttacagttgaagatgatgt |
9946184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 114 - 199
Target Start/End: Complemental strand, 1022214 - 1022129
Alignment:
| Q |
114 |
gaagaagaaacaagaaaccgatatcgttcatatcaatgaacataaaaagatcacggaaaatattgtgcctggtcctaatggacaac |
199 |
Q |
| |
|
|||||||| |||||||||||||||| | || ||| |||| ||||||||| || ||||| ||||| ||||||||| |||||||| |
|
|
| T |
1022214 |
gaagaagacacaagaaaccgatatcatacacatcgatgagcataaaaagggcaaggaaaccattgtacctggtccttttggacaac |
1022129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 892 times since January 2019
Visitors: 6705