View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0906_low_44 (Length: 246)

Name: NF0906_low_44
Description: NF0906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0906_low_44
NF0906_low_44
[»] chr8 (1 HSPs)
chr8 (15-183)||(4607919-4608087)


Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 183
Target Start/End: Original strand, 4607919 - 4608087
Alignment:
15 ctagctcacgggtttctttgttttttagtgggtatctttcatacgtaatagtacacattgttccagaaagttttccaattgttgttggaaccatttgaca 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
4607919 ctagctcacgggtttctttgttttttagtgggtatctttcatacgtaatagtacacattgttccagaaagttttccaattgttgttggaaccatttgcca 4608018  T
115 gtgattttttagattgttattgggtgagttgaaagtactttttgaatttaagattagatatcatatgaa 183  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4608019 gtgattttttagattgttattgggtgagttgaaagtactttttgaatttaagattagatatcatatgaa 4608087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 490 times since January 2019
Visitors: 6704