View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0906_low_47 (Length: 222)
Name: NF0906_low_47
Description: NF0906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0906_low_47 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 32467291 - 32467414
Alignment:
Q |
1 |
tagtatggaatactgtgattgctgctcaatcttatgttgttgaacgataatgctcatgatggtcgatggaagacatgttgtcagttggagtaagccatca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
32467291 |
tagtatggaatactgtgattgctgctcaatcttatgttgttgaacgataatgctcatgatggtcgatggaagacatgttgtcagatggagtaagccatca |
32467390 |
T |
 |
Q |
101 |
ccaggaagggtaaactgtaatatt |
124 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
32467391 |
tcaggaagggtaaactgtaatatt |
32467414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University