View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0906_low_48 (Length: 219)
Name: NF0906_low_48
Description: NF0906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0906_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 52926159 - 52926080
Alignment:
Q |
1 |
ggtggtcttgttcaacttgctattgaagttgaggatcgtgctcaccgctccgcaatcaccagagtaaatgctgatgatgt |
80 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52926159 |
ggtggtcttgttcaacttgctattgaagttgaagatcgtgctcaccgctccgcaatcaccagagtaaatgctgatgatgt |
52926080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University