View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0906_low_50 (Length: 216)
Name: NF0906_low_50
Description: NF0906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0906_low_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 4926861 - 4926992
Alignment:
| Q |
1 |
gtctaaccttgcctcttctttcattatttccttctcttgatctactattaccttcaatattttccttctcattctcattctcctcaagtgttgcttcatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4926861 |
gtctaaccttgcctcttctttcattatttccttctcttgatctactattaccttcaatattttccttctcattctcattctcctcaagtgttgcttcatg |
4926960 |
T |
|
| Q |
101 |
gttgttatcttcacttgtagcttcttcattca |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4926961 |
gttgttatcttcacttgtagcttcttcattca |
4926992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 186 times since January 2019
Visitors: 6702