View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0906_low_51 (Length: 214)

Name: NF0906_low_51
Description: NF0906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0906_low_51
NF0906_low_51
[»] chr1 (1 HSPs)
chr1 (31-202)||(40311261-40311432)


Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 31 - 202
Target Start/End: Complemental strand, 40311432 - 40311261
Alignment:
31 taatagagaaagaaataggttctgcatttatctcaatttatattttgttgatcatgtctgtatttctatagggtttaaattctcaagctcgaatgattaa 130  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40311432 taatagagaaagaaataggttctgcatttatctcaatttat-ttttgttgatcatgtctgtatttctatagggtttaaattctcaagctcgaatgattaa 40311334  T
131 atgcgggatgggcattgagaattttttaagagtttattgcaaaaggt-ggttgggttaagctaactgtatatt 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
40311333 atgcgggatgggcattgagaattttttaagagtttattgcaaaaggtgggttgggttaagctaactgtatatt 40311261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University