View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0906_low_51 (Length: 214)
Name: NF0906_low_51
Description: NF0906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0906_low_51 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 31 - 202
Target Start/End: Complemental strand, 40311432 - 40311261
Alignment:
| Q |
31 |
taatagagaaagaaataggttctgcatttatctcaatttatattttgttgatcatgtctgtatttctatagggtttaaattctcaagctcgaatgattaa |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40311432 |
taatagagaaagaaataggttctgcatttatctcaatttat-ttttgttgatcatgtctgtatttctatagggtttaaattctcaagctcgaatgattaa |
40311334 |
T |
|
| Q |
131 |
atgcgggatgggcattgagaattttttaagagtttattgcaaaaggt-ggttgggttaagctaactgtatatt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40311333 |
atgcgggatgggcattgagaattttttaagagtttattgcaaaaggtgggttgggttaagctaactgtatatt |
40311261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 557 times since January 2019
Visitors: 6704