View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0906_low_52 (Length: 214)
Name: NF0906_low_52
Description: NF0906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0906_low_52 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 21 - 214
Target Start/End: Complemental strand, 7831914 - 7831721
Alignment:
| Q |
21 |
acattacttgagcttgaagcttcctctacagaacaattttggcatttcaacagaataacaatatttctcaccctcccccaaaaggtttctttcccattcc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7831914 |
acattacttgagcttgaagcttcctctacagaacaattttggcatttcaacagaataacaatatttctcaccctctcccaaaaggtttctttcccattcc |
7831815 |
T |
|
| Q |
121 |
agcttctccaaacaagtggatctccatcttgtaactcaacgcttccccaatagcgacgtcttggagctgagacttcatcttcgactcctttcca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7831814 |
agcttctccaaacaagtggatctccatcttgtaactcaacgcttccccaatagcgacgtcttggagctgagacttcatcttcggctcctttcca |
7831721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 738 times since January 2019
Visitors: 6705