View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0906_low_57 (Length: 202)

Name: NF0906_low_57
Description: NF0906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0906_low_57
NF0906_low_57
[»] chr7 (1 HSPs)
chr7 (8-62)||(36964139-36964193)


Alignment Details
Target: chr7 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 8 - 62
Target Start/End: Complemental strand, 36964193 - 36964139
Alignment:
8 accttaagtggtagagtattgcatcattgttaacctcttgaagaagctctctgtg 62  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||| ||||    
36964193 accttgagtggtagagtattgcatcattgttaacctcttgaagaagctctttgtg 36964139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University