View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0907_low_10 (Length: 299)
Name: NF0907_low_10
Description: NF0907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0907_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 72 - 212
Target Start/End: Complemental strand, 14149081 - 14148941
Alignment:
Q |
72 |
ggtgcatgctccaaagcaccactgcattctgatttattttgcatgaaaatgtcaacacacaaaggaccacacaacaaaatataattttcgaacttgtgat |
171 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||||| ||| ||| |||||||||||| |||||||||||||||||||| ||||| |||||||||| |
|
|
T |
14149081 |
ggtgcatgctccaaagcaccactgcattctgatatattttacatagaaaagtcaacacacaagggaccacacaacaaaatatatttttccaacttgtgat |
14148982 |
T |
 |
Q |
172 |
tggtttattctattacagttgaattttcttcttaattataa |
212 |
Q |
|
|
||||||||||||||| |||||||||||||| |||||||||| |
|
|
T |
14148981 |
tggtttattctattatagttgaattttctttttaattataa |
14148941 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University