View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0907_low_14 (Length: 284)
Name: NF0907_low_14
Description: NF0907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0907_low_14 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 30 - 284
Target Start/End: Complemental strand, 26629247 - 26628993
Alignment:
| Q |
30 |
acaatagtgtttgtttttgtttaggttggttgtggtaaagtatgaataatggcttcaagctgaactggcttgattggcatttatttttcaacatggttat |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26629247 |
acaatagtgtttgtttttgtttaggttggttgtggtaaagtatcaataatggcttcaagctgaactggcttgattggcatttatttttcaacatggttat |
26629148 |
T |
|
| Q |
130 |
gttatgtgtacactttttccatcacacatttttcacgctactttttcattgtgtaataaaacaagagaaatatgcttcttaataccaaaagcgtgtgaaa |
229 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26629147 |
gttatgtttaccctttttccatcacacatttttcacactactttttcattgtgtaataaaacaagagaaatatgcttcttaataccaaaagcgtgtgaaa |
26629048 |
T |
|
| Q |
230 |
caaaaaagtgtaaagcagaaagtggtgtgtaagaagcatttctatgtaacttttc |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26629047 |
caaaaaagtgtaaagcagaaagtggtgtgtaagaagcatttctatgtaacttttc |
26628993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1097 times since January 2019
Visitors: 6709