View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0907_low_7 (Length: 323)
Name: NF0907_low_7
Description: NF0907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0907_low_7 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 93 - 323
Target Start/End: Original strand, 6722711 - 6722933
Alignment:
Q |
93 |
gaaacattgaaacaatgcatgtttctttgcctgtataaaattgttatttttgatttcattcactgttctcactcttcgtaatcatctaatcatctaattc |
192 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |||||||||||||||||| || || |
|
|
T |
6722711 |
gaaacattgaaacaatgcatgtttctttgcctatataaaattgttatttttgatttcattcactattcccactcttcgtaatcatctcat--------tc |
6722802 |
T |
 |
Q |
193 |
actcttcgtactcttggtttctctctgaaaaattggtacttttgatttcaaaatcttgaaagagactggacaacatgattttgaaacatacatatttgtt |
292 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
T |
6722803 |
actcttcgtactcttggtttctctctgaaaaattggtacttttgatttcaaaatcttgaaagagactgaaaaacatgattttgaaacatacatatttgtt |
6722902 |
T |
 |
Q |
293 |
tttgttaatttagtgatcatatcttagtttc |
323 |
Q |
|
|
||||||||||||||||||||||||| ||||| |
|
|
T |
6722903 |
tttgttaatttagtgatcatatcttggtttc |
6722933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University