View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_high_11 (Length: 531)
Name: NF0908_high_11
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 400; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 400; E-Value: 0
Query Start/End: Original strand, 98 - 525
Target Start/End: Original strand, 10975739 - 10976166
Alignment:
| Q |
98 |
caaataactcctaccaacccatccaatccaaccagcaatatacaaaaacaatatccctggtgtgataaactcaccccaatgtctttgatcaccattcact |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10975739 |
caaataactcctaccaacccatccaatccaaccagcaatatacaaaaacaatatccctggtgtgataaactcaccccaatgtctttgatcaccattcact |
10975838 |
T |
|
| Q |
198 |
atcaaatgcggtaaaccatcagcaccacacaacaaaccttgctttccatagttatcaaaccttctcttggttttctcaactgttgcttttatggccagcg |
297 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10975839 |
atcaaatgtggtaaaccatcagcaccacacaacaaaccttgctttccatagttatcaaaccttctcttggttttctcaactgttgcttttatggccagcg |
10975938 |
T |
|
| Q |
298 |
ctggagcactgtccggagcgtaaagcttgagggatgattcaagctttttgattgattgtttctcacgtttggcgaattgttttgattctctgcatggtgt |
397 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10975939 |
ctggagcgctgtccggagcgtaaagcttgagtgatgattcaagctttttgattgattgtttctcacgtttggcgaattgttttgattctctgcatggtgt |
10976038 |
T |
|
| Q |
398 |
tagaccggagatgtcggcgacagcggggagtggtgatgagatgaggattgatgagagtgctagtgctgctgaggatgcttttagatttgagtttacatcg |
497 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10976039 |
taggccggagatgtcggcgacagcggggagtggtgatgagatgaggattgatgagagtgctagtgctgctgagaatgcttttagatttgagtttacatcg |
10976138 |
T |
|
| Q |
498 |
ttgcttggtttttcttggtctgtgctgc |
525 |
Q |
| |
|
||| ||||||||||||||| |||||||| |
|
|
| T |
10976139 |
ttggttggtttttcttggtttgtgctgc |
10976166 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 185 times since January 2019
Visitors: 6702