View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_high_111 (Length: 211)
Name: NF0908_high_111
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0908_high_111 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 69; Significance: 4e-31; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 48666398 - 48666466
Alignment:
Q |
135 |
ccaccaaccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctctgct |
203 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48666398 |
ccaccaaccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctctgct |
48666466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 48628155 - 48628223
Alignment:
Q |
135 |
ccaccaaccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctctgct |
203 |
Q |
|
|
|||||||| |||||||||||||| ||| |||| ||| |||| ||||||||||||||||| ||||||| |
|
|
T |
48628155 |
ccaccaacggccactgcttcctctgcctccttcttccacttcattgcatttttcttcaactcctctgct |
48628223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 48584572 - 48584640
Alignment:
Q |
135 |
ccaccaaccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctctgct |
203 |
Q |
|
|
|||||||| |||| |||||||||||| ||| ||| ||||| ||||||||| ||||||| |||||||| |
|
|
T |
48584572 |
ccaccaacggccaaagcttcctccgccttcttcttccacttgtttgcattttgcttcaacttctctgct |
48584640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 147 - 203
Target Start/End: Original strand, 48655834 - 48655890
Alignment:
Q |
147 |
actgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctctgct |
203 |
Q |
|
|
||||| |||||||| ||||| ||| ||||| ||||||||||||||||| ||||||| |
|
|
T |
48655834 |
actgcatcctccgctgccttcttccacttgattgcatttttcttcaactcctctgct |
48655890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 783 times since January 2019
Visitors: 6696