View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0908_high_116 (Length: 203)

Name: NF0908_high_116
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0908_high_116
NF0908_high_116
[»] chr2 (1 HSPs)
chr2 (16-197)||(7372631-7372808)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 16 - 197
Target Start/End: Original strand, 7372631 - 7372808
Alignment:
16 atgaatgctcgatatcttttttgcttcaaattggtttaggcgcagcggatgtgatccatctctcctcannnnnnnncttcataggaacgctattgtcctc 115  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||         |||||| ||||||||||||||||    
7372631 atgaatgctcaatatcttttttgcttcaaattggtttaggcgcagcggatgtgatccatctcttctcattttt----ttcataagaacgctattgtcctc 7372726  T
116 tatgttttagtttaagtggatgatattttgattaatactccacctcttctcgtaatctcattcaagatctcactcacagctg 197  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||    
7372727 tatgttttagtttaagtggatgatattttgattaatactccacttcttctcgtaatctcattcaagatctcattcacagctg 7372808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University