View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_high_32 (Length: 391)
Name: NF0908_high_32
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_high_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 8e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 153 - 366
Target Start/End: Complemental strand, 53090359 - 53090149
Alignment:
| Q |
153 |
cttgcttgtatttgtgtcttttgctttcttcaccgtctaattgaataaaggaagtgaagggnnnnnnnnnnttctgcttttaatttttacttttgtctgt |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53090359 |
cttgcttgtatttgtgtcttttgctttcttcaccgtctaattgaataaaggaagtgaag---aaaaaaaaattctgcttttaatttttacttttgtctgt |
53090263 |
T |
|
| Q |
253 |
gcacaatatataagtaaattcatttgtgttttcaatatagcgtgacaagagaaatgctagcaacacacattgttggaaaatgtatgttagaatgtgtgtt |
352 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| ||| ||| | |||||||||| ||||||| |
|
|
| T |
53090262 |
gcactatatataagtaaattcatttgtgctttcaatatagtgtgacaagagaaatgctagcaacacacattattgaaaagtatatgttagaacgtgtgtt |
53090163 |
T |
|
| Q |
353 |
gataacatttctca |
366 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
53090162 |
gataacatttctca |
53090149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 316 times since January 2019
Visitors: 6696