View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_high_48 (Length: 318)
Name: NF0908_high_48
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0908_high_48 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 11 - 318
Target Start/End: Original strand, 11285948 - 11286255
Alignment:
Q |
11 |
cacagacaagttattaaaaagtaatcacagtttcattgttcaacagcaacaaggaaacaaatcaacaacaaaatactaccttagtgggctccagactcac |
110 |
Q |
|
|
||||||||||||||||||||| ||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
11285948 |
cacagacaagttattaaaaaggaatcacaatttcattgttcgacagcaacgaggaaacaaatcaacaacaaaatactaccttagtgggctctagactcac |
11286047 |
T |
 |
Q |
111 |
aaggccgcaggctcgcgccgctatcccactagagttgcgggaaacagcaacgataccaatagattccggaccaggctacacaaagacattaaaattgaat |
210 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
T |
11286048 |
aaggccacaggctcgcgccgctatcccactagagttgcgggaaacagcaacgataccaatagattccggaccaggctacacaaagacattaaaattgact |
11286147 |
T |
 |
Q |
211 |
gttaacacactaacatcaacaaacaattataaaattgttcaataggtcatcgttgtcattatatgataccttcatcccaatcatctgcacccagtcgaca |
310 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11286148 |
gttaacacactaacatcaacaaacaattataaaattgttcaataggtcatcgttatcattatatgataccttcatcccaatcatctgcacccagtcgaca |
11286247 |
T |
 |
Q |
311 |
gcagttcc |
318 |
Q |
|
|
|||||||| |
|
|
T |
11286248 |
gcagttcc |
11286255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 108 times since January 2019
Visitors: 6700