View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_high_60 (Length: 297)
Name: NF0908_high_60
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_high_60 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 59; Significance: 5e-25; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 38 - 96
Target Start/End: Original strand, 18126049 - 18126107
Alignment:
| Q |
38 |
ccaacaatatgacaagggacccaaagattctcttttggaagttaacttctccatgttta |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18126049 |
ccaacaatatgacaagggacccaaagattctcttttggaagttaacttctccatgttta |
18126107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 164 - 222
Target Start/End: Original strand, 18126175 - 18126233
Alignment:
| Q |
164 |
tgcaataaatgtcctcaatgacaaaccttattatagttgaaaattctctggcttggatt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18126175 |
tgcaataaatgtcctcaatgacaaaccttattatagttgaaaattctctggcttggatt |
18126233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 840 times since January 2019
Visitors: 6697