View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_high_67 (Length: 284)
Name: NF0908_high_67
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_high_67 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 65 - 248
Target Start/End: Original strand, 26578720 - 26578909
Alignment:
| Q |
65 |
tctgcagaagccaaaagaaggacaattaagattataataataaatgagaaaattttgcagttagtatctacggatatcaatttcagtcgtccgatcttaa |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
26578720 |
tctgcagaagccaaaagaaggacaattaagattataataataaatgagaaaattttgcagttagtatctacggctatcaatttcagtcgtctgatcttaa |
26578819 |
T |
|
| Q |
165 |
atcaatggtagtgattatttagttaaggtgtaatgtgaatctatc------gaccttaactcaatgactgagatccaatccagagggtcg |
248 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26578820 |
atcaatggtagcgattattttgttaaggtgtaatgtgaatctatcgaccttgaccttaactcaatgactgagatccaatccagagtgtcg |
26578909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 6 - 65
Target Start/End: Complemental strand, 2844677 - 2844616
Alignment:
| Q |
6 |
atgaacatgattgtggctata--agtgaccctaattgtttccatgcgtgctttatgttatct |
65 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2844677 |
atgaacatgattgtggctatataagtgaccctaattgtttccatgcgtgctttatgttatct |
2844616 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 834 times since January 2019
Visitors: 6696