View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_high_81 (Length: 251)
Name: NF0908_high_81
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0908_high_81 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 3465011 - 3464788
Alignment:
Q |
1 |
ttctctggggcctcctcaattctttttggagccctggattgtgcttgtttcttctctttcaattctagagcactaatctgctactacatgttcagattca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3465011 |
ttctctggggcctcctcaattctttttggagccctggattgtgcttgtttcttctctttcaattctagagcactaatctgctactacatgttcagattca |
3464912 |
T |
 |
Q |
101 |
ttaggtatcacattttgttcttgaatctttctgtttatcttttgtcattgttttc-aaagggtgtatgaataattttgtatatctctttaccgaggtttc |
199 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3464911 |
ttaggtatcacattttcttcttgaatctttctgtttatcttttgtcattgttttcaaaagggtgtatgaataattttgtatatctctttaccgaggtttc |
3464812 |
T |
 |
Q |
200 |
aaattgtgatgcgactaatatagt |
223 |
Q |
|
|
||||||||||| |||||||||||| |
|
|
T |
3464811 |
aaattgtgatgtgactaatatagt |
3464788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University