View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_high_90 (Length: 240)
Name: NF0908_high_90
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_high_90 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 3e-29; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 134 - 199
Target Start/End: Original strand, 48666401 - 48666466
Alignment:
| Q |
134 |
ccaaccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctctgct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48666401 |
ccaaccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctctgct |
48666466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 134 - 199
Target Start/End: Original strand, 48628158 - 48628223
Alignment:
| Q |
134 |
ccaaccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctctgct |
199 |
Q |
| |
|
||||| |||||||||||||| ||| |||| ||| |||| ||||||||||||||||| ||||||| |
|
|
| T |
48628158 |
ccaacggccactgcttcctctgcctccttcttccacttcattgcatttttcttcaactcctctgct |
48628223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 143 - 199
Target Start/End: Original strand, 48655834 - 48655890
Alignment:
| Q |
143 |
actgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctctgct |
199 |
Q |
| |
|
||||| |||||||| ||||| ||| ||||| ||||||||||||||||| ||||||| |
|
|
| T |
48655834 |
actgcatcctccgctgccttcttccacttgattgcatttttcttcaactcctctgct |
48655890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University