View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_high_91 (Length: 235)
Name: NF0908_high_91
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_high_91 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 5 - 216
Target Start/End: Original strand, 41746931 - 41747143
Alignment:
| Q |
5 |
gccatcacattgtttttaattttatctaggaaaacatcatatgataaaaatcagaacccaaataacaaaatgaaaaacaattcttatttctctttttt-a |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
41746931 |
gccatcacattgtttttaattttatctaggaaaacatcatatcataaaaatcagaacccaaataacaaaatgaaaaacaattcttatttctcttttttta |
41747030 |
T |
 |
| Q |
104 |
gttcgtgtaagtccttattctatgtatctattgatgtccttaaatttttatactagatttaactcaaccttacaaaccgatttataaaatgataggtgcg |
203 |
Q |
| |
|
| ||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41747031 |
atgtgtggaagtccttattctatgtatctattgatgtccttaaatttttatactggatttaactcaaccttacaaaccgatttataaaatgataggtgcg |
41747130 |
T |
 |
| Q |
204 |
acttgtaaactga |
216 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41747131 |
acttgtaaactga |
41747143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 70 - 110
Target Start/End: Complemental strand, 43003616 - 43003576
Alignment:
| Q |
70 |
caaaatgaaaaacaattcttatttctcttttttagttcgtg |
110 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||| |||||| |
|
|
| T |
43003616 |
caaaatgagaaacaattcctatttctcttttttaattcgtg |
43003576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University