View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_100 (Length: 309)
Name: NF0908_low_100
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_100 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 201 - 309
Target Start/End: Complemental strand, 12778941 - 12778831
Alignment:
| Q |
201 |
tgtcacttcaatgccttcatcagatatatagagacagttccaaaacacaattgattgaacactatc--taattcaacaaactaatcgaggttgaatacag |
298 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||| |
|
|
| T |
12778941 |
tgtcacttcaatgcttccatcagatatatagagacagctccaaaacacaattgattgaacactatctataattcaacaaactaatccaggttgaatacag |
12778842 |
T |
|
| Q |
299 |
agcttggaaac |
309 |
Q |
| |
|
||||| ||||| |
|
|
| T |
12778841 |
agcttagaaac |
12778831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 65 - 120
Target Start/End: Complemental strand, 12779042 - 12778987
Alignment:
| Q |
65 |
agataatactttcactagtacaatttaaagtcttggtatcaagtttcacatagcta |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12779042 |
agataatactttcactagtacaatttaaagtcttggtatcaagtttcgcatagcta |
12778987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 201 - 261
Target Start/End: Original strand, 18840378 - 18840438
Alignment:
| Q |
201 |
tgtcacttcaatgccttcatcagatatatagagacagttccaaaacacaattgattgaaca |
261 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
18840378 |
tgtcacttcaatgctttcatcagatacatagagaaagttccaaaacacaattgattgaaca |
18840438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 397 times since January 2019
Visitors: 6696