View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_106 (Length: 307)
Name: NF0908_low_106
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0908_low_106 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 52807561 - 52807739
Alignment:
Q |
1 |
aacataggttcttcaactgtttggttattccatgcaaagtttctatggctttctctgcttctgagcttaatggtggcgctgtcgtaagccatggcagcat |
100 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52807561 |
aacataggttcttgaactgtttggttattccatgcaaagtttctatggctttctctgcttctgagcttaatggtggcgctgtcgtaagccatggcagcat |
52807660 |
T |
 |
Q |
101 |
ctctttcagatttgaatgtccctaaccatattctttggtgatttgcatatatttgtgcaccccaatgtccattttgttg |
179 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52807661 |
ctctttcagatttgaatgtccctaaccatattctttggtgatttgcatatatttgtgcaccccaatgtccattttgttg |
52807739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 345 times since January 2019
Visitors: 6696