View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_108 (Length: 306)
Name: NF0908_low_108
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0908_low_108 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 195 - 300
Target Start/End: Original strand, 1552861 - 1552966
Alignment:
Q |
195 |
tttttgtttgcatttgcttgtgtttatctacctaaattaacatcaacaatagcaaaagatagaaagagcacagtggagtggaacatagtgtccacgtggt |
294 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1552861 |
tttttgtttgcatttgcttgtgtttatctacctaaattaacatcaacaatagcaaaagatagaaagagcacagtggagtggaacatagtgtccacgtggt |
1552960 |
T |
 |
Q |
295 |
tggaag |
300 |
Q |
|
|
|||||| |
|
|
T |
1552961 |
tggaag |
1552966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University