View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0908_low_108 (Length: 306)

Name: NF0908_low_108
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0908_low_108
NF0908_low_108
[»] chr2 (1 HSPs)
chr2 (195-300)||(1552861-1552966)


Alignment Details
Target: chr2 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 195 - 300
Target Start/End: Original strand, 1552861 - 1552966
Alignment:
195 tttttgtttgcatttgcttgtgtttatctacctaaattaacatcaacaatagcaaaagatagaaagagcacagtggagtggaacatagtgtccacgtggt 294  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1552861 tttttgtttgcatttgcttgtgtttatctacctaaattaacatcaacaatagcaaaagatagaaagagcacagtggagtggaacatagtgtccacgtggt 1552960  T
295 tggaag 300  Q
    ||||||    
1552961 tggaag 1552966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 305 times since January 2019
Visitors: 6696