View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_110 (Length: 304)
Name: NF0908_low_110
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0908_low_110 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 119; Significance: 8e-61; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 74 - 204
Target Start/End: Original strand, 13929393 - 13929523
Alignment:
Q |
74 |
acaaacaaattgaattgtgtcgggggtacactatcaggtctccaaaacaaacatttattgacaaaataggaatcggtgtattcaaacaaggaatcaacgt |
173 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13929393 |
acaaacaaattgaattgtgtcgggggttcactatcaggtctccgaaacaaacatttattgacaaaataggaatcggtgtattcaaacaaggaatcaacgt |
13929492 |
T |
 |
Q |
174 |
ggagggcatccgattcaccactccacattat |
204 |
Q |
|
|
|||| |||||||||||||||||||||||||| |
|
|
T |
13929493 |
ggagagcatccgattcaccactccacattat |
13929523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 74 - 204
Target Start/End: Original strand, 14043583 - 14043713
Alignment:
Q |
74 |
acaaacaaattgaattgtgtcgggggtacactatcaggtctccaaaacaaacatttattgacaaaataggaatcggtgtattcaaacaaggaatcaacgt |
173 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14043583 |
acaaacaaattgaattgtgtcgggggtacactatcaggtctcggaaacaaacatttattgacaaaataggaatcggtgtattcaaacaaggaatcaacgt |
14043682 |
T |
 |
Q |
174 |
ggagggcatccgattcaccactccacattat |
204 |
Q |
|
|
|||| |||||||||||||||||||||||||| |
|
|
T |
14043683 |
ggagagcatccgattcaccactccacattat |
14043713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 85 - 199
Target Start/End: Complemental strand, 13885147 - 13885032
Alignment:
Q |
85 |
gaattgtgtcgggggtacactatcaggtctccaaaacaaacattt-attgacaaaataggaatcggtgtattcaaacaaggaatcaacgtggagggcatc |
183 |
Q |
|
|
||||||||| | | ||||| |||| || ||||||||||||| ||| ||||| ||||||||| || || ||||||||| |||||||||| |||||| |||| |
|
|
T |
13885147 |
gaattgtgtggtgtgtacattatctggcctccaaaacaaactttttattgataaaataggagtcagtttattcaaaccaggaatcaacatggaggacatc |
13885048 |
T |
 |
Q |
184 |
cgattcaccactccac |
199 |
Q |
|
|
|||||||||| ||||| |
|
|
T |
13885047 |
cgattcaccaatccac |
13885032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University