View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_113 (Length: 301)
Name: NF0908_low_113
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_113 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 146 - 280
Target Start/End: Original strand, 1552832 - 1552966
Alignment:
| Q |
146 |
cacagacacatcttacttcattaaattggtttttgtttgcatttgcttgtgtttatctacctaaattaacatcaacaatagcaaaagatagaaagagcac |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1552832 |
cacagacacatcttacttcattaaattggtttttgtttgcatttgcttgtgtttatctacctaaattaacatcaacaatagcaaaagatagaaagagcac |
1552931 |
T |
 |
| Q |
246 |
agtggagtggaacatagtgtccacgtggttggaag |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1552932 |
agtggagtggaacatagtgtccacgtggttggaag |
1552966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University