View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_116 (Length: 299)
Name: NF0908_low_116
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_116 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 6e-74; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 115 - 263
Target Start/End: Complemental strand, 29290983 - 29290835
Alignment:
| Q |
115 |
tgcaggaagtgttgattgttggagtttccaagaaatggcttggagtttcaaagaatcattttttctgcgctaccaatttttagtgcagaacgagcatcta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29290983 |
tgcaggaagtgttgattgttggagtttccaagaaatggcttggagtttcaaagaatcattttttctgcgctaccaatttttagtgcagaacgagcaccta |
29290884 |
T |
|
| Q |
215 |
cttttgtgtttacaatgtggagaatttggaagagttggagcttgcgcgt |
263 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29290883 |
cttctgtgtttacaatgtggagaatttggaagagttggagcttgcgcgt |
29290835 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 115 - 291
Target Start/End: Complemental strand, 35236550 - 35236375
Alignment:
| Q |
115 |
tgcaggaagtgttgattgttggagtttccaagaaatggcttggagtttcaaagaatcattttttctgcgctaccaatttttagtgcagaacgagcatcta |
214 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||| | || |||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
35236550 |
tgcaggaagtgttgcttgttggagtttcgaagatacgg-ttggagtttcaaagaatcattttttctgcgctgccaatttttagtgcagaatgagcatcta |
35236452 |
T |
|
| Q |
215 |
cttttgtgtttacaatgtggagaatttggaagagttggagcttgcgcgtttgggagaaacaaacagaaacgcgcgca |
291 |
Q |
| |
|
|||||||||| | | |||||||||||||||||||| ||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
35236451 |
cttttgtgttcatattgtggagaatttggaagagtcggaacttgcgtgtttgggagaaacaaacagaaacacgcgca |
35236375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 21 - 120
Target Start/End: Original strand, 52926080 - 52926179
Alignment:
| Q |
21 |
acatcatcagcatttactctggtgattgcggagcggtgagcacgatcctcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagg |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926080 |
acatcatcagcatttactctggtgattgcggagcggtgagcacgatcttcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagg |
52926179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 258 - 299
Target Start/End: Complemental strand, 29287703 - 29287662
Alignment:
| Q |
258 |
gcgcgtttgggagaaacaaacagaaacgcgcgcatctcaact |
299 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29287703 |
gcgcgtttgggagaaacaaacagaaacacgcgcatctcaact |
29287662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 221 times since January 2019
Visitors: 6702