View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0908_low_119 (Length: 297)

Name: NF0908_low_119
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0908_low_119
NF0908_low_119
[»] chr2 (2 HSPs)
chr2 (38-96)||(18126049-18126107)
chr2 (164-222)||(18126175-18126233)


Alignment Details
Target: chr2 (Bit Score: 59; Significance: 5e-25; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 38 - 96
Target Start/End: Original strand, 18126049 - 18126107
Alignment:
38 ccaacaatatgacaagggacccaaagattctcttttggaagttaacttctccatgttta 96  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18126049 ccaacaatatgacaagggacccaaagattctcttttggaagttaacttctccatgttta 18126107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 164 - 222
Target Start/End: Original strand, 18126175 - 18126233
Alignment:
164 tgcaataaatgtcctcaatgacaaaccttattatagttgaaaattctctggcttggatt 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18126175 tgcaataaatgtcctcaatgacaaaccttattatagttgaaaattctctggcttggatt 18126233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University