View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_120 (Length: 296)
Name: NF0908_low_120
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_120 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 58 - 236
Target Start/End: Complemental strand, 35310620 - 35310442
Alignment:
| Q |
58 |
aaaatcagaactcctcatgtgtaagaccttaacatggacggataaccaaaacatttgtctaatataatctttataaatttggaaaggttttaactttata |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35310620 |
aaaatcagaactcctcatgtgtaagaccttaacatggacggataaccaaaacatttgtctaatctaatctttataaatttggaaaggttttaactttata |
35310521 |
T |
 |
| Q |
158 |
tcccgattcacatcctttttcttctctaccaaacaaaccagatatagttttatttacaaactttagcaactagattatg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35310520 |
tcccgattcacatcctttttcttctctaccaaagaaaccagatatagttttatttacaaactttagcaactagattatg |
35310442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University