View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0908_low_120 (Length: 296)

Name: NF0908_low_120
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0908_low_120
NF0908_low_120
[»] chr4 (1 HSPs)
chr4 (58-236)||(35310442-35310620)


Alignment Details
Target: chr4 (Bit Score: 171; Significance: 7e-92; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 58 - 236
Target Start/End: Complemental strand, 35310620 - 35310442
Alignment:
58 aaaatcagaactcctcatgtgtaagaccttaacatggacggataaccaaaacatttgtctaatataatctttataaatttggaaaggttttaactttata 157  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
35310620 aaaatcagaactcctcatgtgtaagaccttaacatggacggataaccaaaacatttgtctaatctaatctttataaatttggaaaggttttaactttata 35310521  T
158 tcccgattcacatcctttttcttctctaccaaacaaaccagatatagttttatttacaaactttagcaactagattatg 236  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
35310520 tcccgattcacatcctttttcttctctaccaaagaaaccagatatagttttatttacaaactttagcaactagattatg 35310442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 490 times since January 2019
Visitors: 6696