View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_123 (Length: 294)
Name: NF0908_low_123
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_123 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 50 - 196
Target Start/End: Complemental strand, 22162510 - 22162365
Alignment:
| Q |
50 |
atagtcctcaataacttgcactcttactttctag-gtggctatgttcaaaatattggtcatgcaacatctttggaggctgagatttgtgctacaatgtat |
148 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22162510 |
atagtcgtcaataactggcactcttactttctagagtggctatcttcaaaatattggtaatgcaacatctttggaagctgagatttgtgctacaatgtat |
22162411 |
T |
 |
| Q |
149 |
gccttagagaaagatgaggaaatgaattggagagacatatggatagaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
22162410 |
gccttagagaaagatgaggaaatgaatag--gagacatatggatagaa |
22162365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University