View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_124 (Length: 294)
Name: NF0908_low_124
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0908_low_124 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 11 - 265
Target Start/End: Original strand, 10812312 - 10812566
Alignment:
Q |
11 |
tagctgttgcgacgagatggtgttggtttgcttcctctttcaccataagaggctgcacaatgcattagtgtttggcatttgacatcactaacaagttgtg |
110 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10812312 |
tagcttttgcgacgagatggtgttggtttgcttcctctttcaccataagaggctgcacaatgcattagtgtttggcatttgacatcactaacaagttgtg |
10812411 |
T |
 |
Q |
111 |
aagccatgttgtttggttattagtgcttagaaggagagagggagtgtgtgatatgtggagaataaggtgtgtcctctcttactcactctttgtctcttaa |
210 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
10812412 |
aagccatgttgtttggttgttagtgcttagaaggagagagggagtgtgtgatatgtggagaataaggtgtgccctctcttactcactctttgtctcttaa |
10812511 |
T |
 |
Q |
211 |
attctacttgatttttgcaactattggtggctttatatagagaaggccaatatag |
265 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
10812512 |
attctacttgatttttgcaactattggtggctttatatagagaatgccaatatag |
10812566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University