View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_129 (Length: 290)
Name: NF0908_low_129
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_129 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 70 - 248
Target Start/End: Complemental strand, 31718593 - 31718415
Alignment:
| Q |
70 |
cactcgcgtcatattctactgagtaaacctgtcactagccagaaaaccaataccttacattccattagcaaataaagaacacatcatgtcaattgtagtc |
169 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31718593 |
cactcgcatcatattctaccgagtaaacctgtcactaatcagaaaatcaataccttacattccattagcaaataaagaacacatcatgtcaattgtagtc |
31718494 |
T |
|
| Q |
170 |
aaggactgtctagtattgatttcatatttctttaacttcggcaaccataaaagattgaaacaagagccaatgcaacagc |
248 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31718493 |
aaggactgtctagtattcatttcatatttctttaacttcggcaaccataaaagattgaaacaagagccaatgcaacagc |
31718415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 682 times since January 2019
Visitors: 6696