View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_130 (Length: 287)
Name: NF0908_low_130
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0908_low_130 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 71 - 240
Target Start/End: Original strand, 16358318 - 16358489
Alignment:
Q |
71 |
ttaagggaatataaaacatgggctccagaaggtaacaattcagctactttgtttcccatgttgaaattgaggagcattgcctttagatttagatgtacta |
170 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16358318 |
ttaagggaatataaaacatgggctccagaaggtaacaattcagctactttgtttcccatgttgaaattgaggagcattgcctttagatttagatgtacta |
16358417 |
T |
 |
Q |
171 |
tat--aaaagataaatggatgctaatgcnnnnnnnnnnnngaggtctcttgtcaatatacgtattccctatg |
240 |
Q |
|
|
||| ||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
T |
16358418 |
tataaaaaagataaatggatgctaatgctttttattttttgaggtctcttatcaatatacgtattccctatg |
16358489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University