View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0908_low_135 (Length: 284)

Name: NF0908_low_135
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0908_low_135
NF0908_low_135
[»] chr1 (1 HSPs)
chr1 (44-224)||(15286520-15286700)


Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 44 - 224
Target Start/End: Complemental strand, 15286700 - 15286520
Alignment:
44 aatatcccaaagttaaatttcttgaattacttatgaaatggaataaaataatgtatgaagtttagaaaacacggaaaaacacctgaggttgcatgcatgg 143  Q
    ||||||| | |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
15286700 aatatcctagagttaaatttcttgaattacttatgaaatggaataaaataatgtgtgaagtttagaaaacacggaaaaacacctgaggttgcatgcatgg 15286601  T
144 gttaagagattctcttgcttcgatttcccaaatgtcagtagtactatctgctactgctatgatcacattgatgaggatttt 224  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15286600 gttaagagattctcttgcttcgatttcccaaatgtcagtagtactatctgctactgctatgatcacattgatgaggatttt 15286520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University