View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_135 (Length: 284)
Name: NF0908_low_135
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_135 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 44 - 224
Target Start/End: Complemental strand, 15286700 - 15286520
Alignment:
| Q |
44 |
aatatcccaaagttaaatttcttgaattacttatgaaatggaataaaataatgtatgaagtttagaaaacacggaaaaacacctgaggttgcatgcatgg |
143 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15286700 |
aatatcctagagttaaatttcttgaattacttatgaaatggaataaaataatgtgtgaagtttagaaaacacggaaaaacacctgaggttgcatgcatgg |
15286601 |
T |
|
| Q |
144 |
gttaagagattctcttgcttcgatttcccaaatgtcagtagtactatctgctactgctatgatcacattgatgaggatttt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15286600 |
gttaagagattctcttgcttcgatttcccaaatgtcagtagtactatctgctactgctatgatcacattgatgaggatttt |
15286520 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 531 times since January 2019
Visitors: 6696