View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_137 (Length: 282)
Name: NF0908_low_137
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_137 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 29 - 270
Target Start/End: Complemental strand, 26324855 - 26324614
Alignment:
| Q |
29 |
agaattatggaaggtttatttatcacaacatagcaagggtcaatgggttgatgcatgtgaccttgagtttaaaaatggtaataggcctgtggtttattct |
128 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26324855 |
agaattatggatggtttatttatcacaacatagcaagggtcaatgggttgatgcatgtgaccttgagtttaaaaatggtaataggcctgtgctttattct |
26324756 |
T |
|
| Q |
129 |
tcattgcatggtcatgcattgtttcctaggccagggtgtgttatgcaaggtgttagagggtttggtataaggaatgatgcatgtaagagtgatttggtga |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26324755 |
tcattgcatggtcatgcattgtttcctaggccagggtgtgttatgcaaggtgttagagggtttggtataaggaatgatgcatgtaagagtgatttggtga |
26324656 |
T |
|
| Q |
229 |
tggatatggttaaagggtatgaaatagttgctgctgaatatt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26324655 |
tggatatggttaaagggtatgaaatagttgctgctgaatatt |
26324614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 481 times since January 2019
Visitors: 6696