View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_142 (Length: 277)
Name: NF0908_low_142
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_142 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 122 - 179
Target Start/End: Original strand, 15089176 - 15089233
Alignment:
| Q |
122 |
ggcgtatgagattgtttgcatgagaggatgggttggtgagggagtgtatggaacagtt |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15089176 |
ggcgtatgagattgtttgcatgagaggatgggttggtgagggagtgtatggagcagtt |
15089233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 85 - 124
Target Start/End: Original strand, 15089086 - 15089125
Alignment:
| Q |
85 |
ggatgtcgaataatattattagatgggtgggggatggggc |
124 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
15089086 |
ggatgtcggataatgttattagatgggtgggggatggggc |
15089125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 208 times since January 2019
Visitors: 6695