View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_144 (Length: 273)
Name: NF0908_low_144
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_144 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 5e-65; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 1 - 181
Target Start/End: Complemental strand, 48107944 - 48107775
Alignment:
| Q |
1 |
aggcgttcattctttggactacgattattttgctactattgaggtaataatattgacacatcttttaatatgattattaattcttaaacattatattgca |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
48107944 |
aggcgttcattctttggactatgattattttgctactattgaggtaat------gacacatcttttaatatgattattaattcttaaacatt-----gca |
48107856 |
T |
|
| Q |
101 |
taaactttcttgtgttgtcaatgccttgaaataaaacagtgtatgaaagaacctcaaagagcacaatatggagggggaatt |
181 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48107855 |
taaattttcttgtgttgtcaatgccttggaataaaacagtgtatgaaagaacctcaaagagcacaatatggagggggaatt |
48107775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 121 - 174
Target Start/End: Complemental strand, 48064166 - 48064113
Alignment:
| Q |
121 |
atgccttgaaataaaacagtgtatgaaagaacctcaaagagcacaatatggagg |
174 |
Q |
| |
|
||||||||||||||| |||||| ||| ||||||| | || |||||||||||||| |
|
|
| T |
48064166 |
atgccttgaaataaagcagtgtgtgacagaacctaagagggcacaatatggagg |
48064113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 95 - 171
Target Start/End: Complemental strand, 48101445 - 48101369
Alignment:
| Q |
95 |
attgcataaactttcttgtgttgtcaatgccttgaaataaaacagtgtatgaaagaacctcaaagagcacaatatgg |
171 |
Q |
| |
|
|||||| |||||| ||||||||| |||||||| ||| ||| |||||| ||| ||||||| | || ||||||||||| |
|
|
| T |
48101445 |
attgcacaaacttacttgtgttgccaatgcctataaacaaagcagtgtgtgacagaacctaagagggcacaatatgg |
48101369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 535 times since January 2019
Visitors: 6696