View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_149 (Length: 266)
Name: NF0908_low_149
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_149 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 47 - 125
Target Start/End: Original strand, 34453377 - 34453455
Alignment:
| Q |
47 |
tactccttatacgtgttgcagaaattttcatattcccgtatattgtattcagaatttgcttgataatattgtgattaac |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34453377 |
tactccttatacgtgttgcagaaattttcatattcccgtatattgtattcagaatttgcttgataatattgtgattaac |
34453455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 198 - 241
Target Start/End: Original strand, 34453529 - 34453572
Alignment:
| Q |
198 |
tttcacttaatcaaccaaggaaatcccaaatgatacatattctt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34453529 |
tttcacttaatcaaccaaggaaatcccaaatgatacataatctt |
34453572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 138 - 166
Target Start/End: Original strand, 34453469 - 34453497
Alignment:
| Q |
138 |
aaggaatattgtgattaacttagtttgtg |
166 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34453469 |
aaggaatattgtgattaacttagtttgtg |
34453497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 339 times since January 2019
Visitors: 6696