View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_154 (Length: 263)
Name: NF0908_low_154
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0908_low_154 |
 |  |
|
[»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 33 - 263
Target Start/End: Original strand, 28283479 - 28283709
Alignment:
Q |
33 |
gcatgagaaaaattgagcgactccttcggtccacatggtccgctaccaaatattccactttcatatttcttgaagtcatcgttaatcgcgattgcaactg |
132 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28283479 |
gcatgagaaaaattgagcgactccttcggtccacatggtccgctaccaaatattccactttcatatttcttgaagtcatcgttaatcgcgattgcaactg |
28283578 |
T |
 |
Q |
133 |
taaccggctgttctgccactgcttctaataggttttgttcgccgggtgatactattacataaccatcaatttttgcagcacggtcttttctgttgctaag |
232 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
T |
28283579 |
taaccggctgttgtgccactgcttctaataggttttgttcgccgggtgatactattacataaccatcaattttcgcagcacggtcttttttgttgctaag |
28283678 |
T |
 |
Q |
233 |
gcatgtacccactttttctgtgtaaggataa |
263 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
28283679 |
gcatgtacccactttttctgtgtaaggataa |
28283709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 88
Target Start/End: Complemental strand, 28004733 - 28004703
Alignment:
Q |
58 |
tcggtccacatggtccgctaccaaatattcc |
88 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
28004733 |
tcggtccacatggtccgctaccaaatattcc |
28004703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University