View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_155 (Length: 262)
Name: NF0908_low_155
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_155 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 9126340 - 9126572
Alignment:
| Q |
1 |
cttcaatgtggataagaggcgagactttacattcctattcatgtcgagttaaatcatcatccctttcattctttctttcacgctttgactttctcgacca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
9126340 |
cttcaatgtggataagaggcgagactttacattcctattcatgtcgagttaaatcatcatccatttcattctttctttcacactttgactttctcgacca |
9126439 |
T |
 |
| Q |
101 |
acaataagtctttcagggaaaataggctaatcctcggtatttgtctcactgctcctttgcctcatccaacccctagtgaagatgtattatcattatgagg |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
9126440 |
acaataagtctttcagggaaaacaggctaatcctcggtatctgtctcactgctcctttgcctcatccaaaccctagtgaagatgtattatcattatgagg |
9126539 |
T |
 |
| Q |
201 |
ttttctcttcatgtagatcttcaaagaaggatc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
9126540 |
ttttctcttcatgtagatcttcaaagaaggatc |
9126572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University