View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_156 (Length: 260)
Name: NF0908_low_156
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_156 |
 |  |
|
| [»] scaffold0240 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 28 - 229
Target Start/End: Complemental strand, 33053063 - 33052862
Alignment:
| Q |
28 |
tttatgccattgaaggaatatagtagatgctcttccaccgcgaatatcccacacatagacaatcccatgcctcccagcaccataaataatatgattttct |
127 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||||||||| | ||||||| |
|
|
| T |
33053063 |
tttatgcccttgaaggaatgtagtagatgctcttccaccgcgaatatcccacacatacacgatcccatgcctcctagcaccataaataatcttattttct |
33052964 |
T |
 |
| Q |
128 |
gcatctaattggatgttgttaatggtacaaaatgaagcatatgttagttcctggcaaagtagactctttacttttctaccccaaacgttaattgtaccat |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
33052963 |
gcatctaattggatgttgttaatggtacaaaatgaagcagatgttagttcgaggcaaggtagactctttacttttctaatccaaacgttaattgtaccat |
33052864 |
T |
 |
| Q |
228 |
gc |
229 |
Q |
| |
|
|| |
|
|
| T |
33052863 |
gc |
33052862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 57; Significance: 7e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 49 - 117
Target Start/End: Complemental strand, 24866549 - 24866481
Alignment:
| Q |
49 |
agtagatgctcttccaccgcgaatatcccacacatagacaatcccatgcctcccagcaccataaataat |
117 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
24866549 |
agtagatgctcttccaccacgaatatcccacacatacacgatcccatgcctcccagcaccataaataat |
24866481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 122 - 229
Target Start/End: Complemental strand, 24865968 - 24865861
Alignment:
| Q |
122 |
ttttctgcatctaattggatgttgttaatggtacaaaatgaagcatatgttagttcctggcaaagtagactctttacttttctaccccaaacgttaattg |
221 |
Q |
| |
|
||||||||||||||||||| | |||||| ||||| |||||||||| |||||||||| ||||| | || ||||||||| ||||| ||||||| ||||| | |
|
|
| T |
24865968 |
ttttctgcatctaattggacgctgttaagggtaccaaatgaagcagatgttagttcgaggcaaggcaggctctttactcttctatcccaaacattaatcg |
24865869 |
T |
 |
| Q |
222 |
taccatgc |
229 |
Q |
| |
|
|||||||| |
|
|
| T |
24865868 |
taccatgc |
24865861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0240 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: scaffold0240
Description:
Target: scaffold0240; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 30 - 83
Target Start/End: Complemental strand, 15643 - 15590
Alignment:
| Q |
30 |
tatgccattgaaggaatatagtagatgctcttccaccgcgaatatcccacacat |
83 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
15643 |
tatgccattgaaggaatgtaatagatgctcttccaccgcgaatatcccacacat |
15590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University