View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_159 (Length: 255)
Name: NF0908_low_159
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0908_low_159 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 1 - 131
Target Start/End: Original strand, 33885850 - 33885980
Alignment:
Q |
1 |
ttcttttcttttttgtgtgactctttaatgcattcttaagtgtagctgattttgaatattgtggacaatttctattttacagccactggtgaaaactgca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33885850 |
ttcttttcttttttgtgtgactctttaatgcattcttaagtgtagctgattttgaatattgtggacaatttctattttacagccactggtgaaaactgca |
33885949 |
T |
 |
Q |
101 |
agggagacccttatgagaatgttatattctt |
131 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
33885950 |
agggagacccttatgagaatgttatattctt |
33885980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University