View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_163 (Length: 251)
Name: NF0908_low_163
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_163 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 29 - 247
Target Start/End: Complemental strand, 43099982 - 43099764
Alignment:
| Q |
29 |
aatagacactgaattctttggtaccacgcaaaataagcctaatgcttcgatgtcaaatgtgtgctctagactcttaaattaatcaattacctcatttcat |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
43099982 |
aatagacactgaattctttggtaccacgcaaaataagcctaatgcttcgatgtcaaatgtgtgcactagactcttaaattaatcaattacctcatttcat |
43099883 |
T |
|
| Q |
129 |
cagtcactaaaatccattttgctatgacaaacaaatattgttcaattacaatacttcatccctacatactacatggacaagtcaatgaattagatttaaa |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43099882 |
cagtcactaaaatccattttgctatgacaaacaaatattgttcaattacaatacttcatccctacatactacatggacaagtcaatgaattagatttaaa |
43099783 |
T |
|
| Q |
229 |
atcctatgcacatgcaaaa |
247 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
43099782 |
atcctatgcacatgcaaaa |
43099764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 612 times since January 2019
Visitors: 6696